The mRNA Transcribed from the Backside Strand of the DNA
The method of gene transcription is an integral a part of gene expression, whereby the genetic data saved in a gene is translated into messenger RNA (mRNA). On this evaluation, the gene sequence 3’GTAACCGTATTGCAGCTATTAGCAGCCATG5′ might be analyzed to find out the mRNA that will be transcribed from this part of the gene.
The mRNA transcribed from the underside strand of the given gene sequence is 5’AUGUUGGCUAAGCAGUAUUAGCGAGCCUAC3′. This gene sequence is part of the messenger RNA (mRNA) molecule, which is the template for protein translation and is transcribed from the DNA template strand (Girard et al., 2019). Throughout transcription, the complementary sequence on the mRNA is fashioned from the DNA template strand (Mittapalli et al., 2020). The mRNA sequence is then used for protein translation by the ribosomes within the cell. In abstract, the underside strand of the DNA given within the query carries the gene, and the mRNA that will be transcribed from this part of the gene is 5’AUGUUGGCUAAGCAGUAUUAGCGAGCCUAC3′.